In Real Life

The Trials HD Riddle: A Look At Gaming’s Da Vinci Code

Most of you know Trials HD as the punishingly difficult 2D racer on Xbox LIVE Arcade – but buried deep within the impossible jumps and the incredible physics puzzles is something far more elusive – a riddle. A fiendish riddle that would make Da Vinci dribble. In this one-of-a-kind feature Kotaku reader, and Trials HD obsessive, FatShady breaks down this incredible puzzle and speaks to the creators of the game to try and uncover the intriguing mystery that is… The Trials HD Riddle.

The Beginning

But what is the Trials HD riddle? So far we have very little idea with regards to how the individual pieces hang together – but, for now, it’s a series of clues – buried deep within the tracks of Trials HD – clues that work together to create a bizarre mystery that is as yet unsolved, a series of Easter Eggs loosely tied together in a way we can’t yet fathom.

Few who play, or even finish the game in its entirety, will be aware of their existence. The clues found so far can be seen in this video.

Surprised? Even aware that these secret areas even existed in a game such as this? We asked FatShady to explain the clues one by one.

The Clues

The Fibonacci Number

This secret is a representation of the Fibonacci Sequence or the Golden Ratio. The first two Fibonacci numbers are 0 and 1, and each subsequent number is the sum of the previous two, for example, 0, 1, 1, 2, 3, 5, 8, 13, 21.

Cave Painting

This secret is thought to be a cave painting, specifically the ‘Lascaux Hunters’ from the cave paintings located in France.


Known as “the prehistoric Sistine Chapel,” the Lascaux Caves, a cave complex in south-western France, contain some of the most remarkable paleolithic cave paintings in the world, from at least 15,000 years ago. Here is a highlighted image showing the hunter pictured above.

Number 42

The number 42 is thought to be a reference to the movie ‘The Hitchhiker’s Guide to the Galaxy’ and in particular, the ‘answer to the ultimate question of life, the universe and everything’ (which of course is 42).

Interstellar Envelope

The clue here is two circles with a line connecting them.


This symbol has been identified as one part of the Interstellar envelope, a golden record that was placed on the Voyager spacecraft in 1977 and sent into space as a way of humans communicating to other intelligent life. This symbol is located in the bottom right section of the record. While it is not currently known how this image relates to the riddle, it has been suggested that this record has something in common with Leonardo Da Vinci’s notebook.


As it relates to the record, this diagram illustrates the two lowest states of the hydrogen atom. The vertical lines with dots indicate the spin moments of the proton and electron. The transition time from one state to the other provides the fundamental clock reference used in all the cover diagrams and decoded pictures.

1452

Given that Leonardo Da Vinci features elsewhere within this riddle, these numbers are thought to represent the year that Da Vinci was born.

Flapping Wing

This image shows a hand-like mechanical structure. This is thought to be a representation of a sketch made by Leonardo Da Vinci.


Here is the original sketch made by Leonardo Da Vinci depicting the flapping wing. This image can be found within the book ‘Leonardo’s Notebooks’.

De Divina Proportione
There are two secrets that are provided here. Only when they are combined do they reveal the answer.

D__I _IN___OPO__ION_


_ED_V__APR___RT___E


DE DIVINA PROPORTIONE

This translates to “The Divine Proportion”, a manuscript by Luca Pacioli which concerns mathematical proportion and the golden ratio.

While the title of the text has been discovered, it seems that the more relevant clue here is the line with dots, along with the number 4 representing a certain part of this image. It is not currently known how this text relates to this image, or more importantly how it relates to the overall riddle.

Fibonacci Pattern with Binary

The Fibonacci pattern is again shown here. This secret is special however because in addition to the image, it shows a series of dots below the image. Clues have been provided to suggest that the dots at the bottom of this image are actually binary code (dot = 1, space = 0). It reads 10101001111.

As this is the image of the Fibonacci pattern shown above, has the binary code been reversed? It is not clear exactly what this means. What does this clue signify?

Orion Constellation

This secret is located on the level ‘Space Station’. Therefore this image is thought to be of a constellation.


These stars represent the Orion Constellation. The three stars in the middle being Orion’s belt. The Orion constellation is also known as the hunter. It can also be viewed from within the Great Pyramid in Egypt via a small shaft. This however (considering the responses below), may be a reference to the Orion Spacecraft, which is a current initiative of NASA to explore deeper into space that we have gone before.

Roman Numerals

The numbers read: 3-18-15-1-20-15-1-14

If those numbers were deciphered using a simple Alpha-Numeric Substitution Cipher (ie, a=1, b=2,c=3), they spell out the word “Croatoan”.

There is a story of a ‘lost colony’ who carved the word “Croatoan” into a tree in the settlement of Roanoke. This was the only clue given to the group’s leader, John White, after he left back to England to get supplies. The English government officially declared the colony of Roanoke “lost” in 1597. It has since, however, been proven by DNA analysis that the missing settlers/colonists were integrated into the Croatoan Tribe living south of Roanoke.

Darwin’s Tree of Life

Charles Darwin is commonly known for his revolutionary theory of evolution, which would be documented in his work titled ‘On the Origin of Species’. During the 20 years he worked on this, he kept a number of notebooks. In one of them, from approximately 1837, he sketched the following to describe the evolutionary process.


On a side note, knowing what we do about the theory of evolution and how revolutionary it is, I like that even Darwin writes ‘I think’ above this image suggesting this idea was in its infancy.

Cardboard Boxes

There are two boxes represented in this image.


The box on the left has been identified. It is a recreation of a ‘Tannen’s Magic Mystery Box’. What is more interesting about this box however is its owner, JJ Abrams (Lost, Fringe, Mission impossible 3). It turns out that Mr Abrams was the guest editor of the April 2009 edition of Wired magazine. This magazine had a large number of puzzles hidden within its pages. It turned out that the puzzles all linked together to form a larger riddle (sound familiar yet?). As these two boxes are located in very close proximity, it is thought that they are connected.


The box on the right of the image however is a complete mystery. The box is cardboard with packing tape over it. It has the writing SU-122 crossed out and below it is the writing SKA-788. In order to progress this riddle, the game developers sent a package out to a fan of the game that was a recreation of the box. This recreation was said to hold a clue to what the box was. Inside the box was a 6.2m panorama that is made up of a series of street view images taken from Commercial Street in London. This street is famous for the Jack the Ripper murders.

Binary Co-ordinates

The binary code reads 1011110100111 N, 10011110101101 E

To decipher this one, first binary was converted to decimal, then the decimal outcome was converted to Longitude and Latitude. The result was 60° 32′ 59.9994″, 101° 34′ 11.9994″ which is a location in the middle of Russia.


Further investigation resulted in the discovery of the Tunguska Event. This was the site of a massive natural explosion that occurred in 1908. The explosion is believed to have been caused by the air burst of a large meteoroid or comet fragment at an altitude of 5–10 kilometres (3–6 mi) above the Earth’s surface. The explosion is thought to have knocked down an estimated 80 million trees.

DNA Sequence

This is thought to represent DNA because of the letters used representing the 4 building blocks of DNA (Adenine, Cytosine, Guanine, Thymine).

The letters are thought to read CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT however the image is difficult to read in parts. There are 40 letters in total.

The Map

The clue is a map of the world with a piece missing. This map shows rhumb lines radiating from a circular pattern of wind roses or compass roses which indicate various winds and compass directions. This is common in Portolan charts of the 1500′s.


The missing piece of the map is known as the Piri Reis Map. This map was created in 1513 but was only rediscovered in 1929. Like other portolan charts of the time, the Piri Reis Map exhibits a network of rhumb lines and compass roses. This is the only surviving remnant of what was thought to be a much larger map.

Mammoth

So far, this is just a Mammoth, an extinct relative of modern day elephants. It is not clear what significance this mammoth has to the overall riddle. Could it relate to the modern discovery of a frozen mammoth, or the work currently underway to map the DNA and potentially clone the mammoth? No-one knows?

Speaking To The Creators

In an attempt to dig deeper into this riddle, FatShady spoke to Redlynx Developer ANBA, who not only was heavily involved in the development of Trials HD, but created this riddle. Here is what he had to say.

For the record, what is your real name and title?
I am Antti Ilvessuo, Creative Director and Co-Founder of RedLynx. In the forums my tag is ANBA, and on the office wrestling mat, my nickname is “The Dreadnaught,” because I am like the old naval battleships, large and obsolete.

Where did the inspiration come from to create such a complex Easter egg hunt?
Always when watching movies or TV series I’ve been more interested in the backstory and world rather than the current plot itself. In my mind, it creates a deeper feeling and interest toward the “product”. And about Easter eggs, they are in my mind more than that, since Easter eggs are usually just fun, goofy stuff. These are secrets that have “meaning.”

Something like Lost had a lot of pretty good stuff that really pointed out the way that things have been thought in the background. Of course I was not a big fan of the ending, but the journey of watching Lost was a fun one. Maybe that was the meaning of the series, I don’t know.

Also I think the Lord of the Rings had some influence on this. I’m not a big fan of the book in the way that people usually are, more like I think it’s just awesome that there is a real history behind the books and events there, not just a made up slice of the universe.

It has been 18 months since the game was released and while progress has been made, no one has solved the riddle. Do you consider an unresolved riddle a success or a failure?
Success definitely, both personally for myself and for the people that are looking to solve it. If it would have been nailed in first day…what good is that? Many small details would have been lost, some small information or interesting facts. Nobody would have found those. Some missteps could not have been taken, but those always are good. You learn and your imagination and desire to know would have not been tickled. All lost forever. So no, unsolved riddles are not failures, not at all.

Are you concerned that this riddle will never be solved?
No. ;)

How hard has it been to keep this secret to yourself for so long? Does anyone else know the answer?
Not hard. Most people don’t even know that it’s there. Some know it’s there, but they know I won’t say anything. Our P.R. director knows the answer – I told him because if a meteor hit me, the answer would be lost forever!

That might sound like a strange fear, but meteors come close to Earth all of the time. I have instructed my IT guys to set up a screen in the office that constantly monitors all meteors and near-Earth objects at all time, using the data from this NASA website.

Finland is known as the land of 100,000 lakes, and I fear that another will be created by falling meteor. If it should land on me, they can call it Lake Antti.

The most common question I hear is from people who don’t even know what they are looking for. For example, is the riddle a phrase, a movie title, a poem, a person? What clue/s would you say hold the ‘key’ to linking the clues together and finally solving this riddle?
There are two things. What is the question AND what do the things that have been found so far mean? Right now, people stop when something is confirmed maybe just too bit early. And hmm, as to the question. Well maybe there is hint in this answer?

They stop and don’t seem to think about the combination of all things and what they could mean. Like the map, you found part of it but then what? How could we have a map that is not found? What is the map that we have?

Finally, has any clue been missed or ‘solved’ incorrectly? Would like to correct/point us in the right direction?
There was a box that was opened. It said, “Don’t open it!” so that was a turn in the wrong direction. Maybe the box would be more meaningful if it were closed, not opened.

But otherwise it’s all been pretty much good. Hmm, regarding Ode to Joy: the notes are from the song, but they don’t form code. If they would have made been in code, that would have been really awesome. Or maybe there is code in Ode to Joy actually, but that was not the meaning. But if there is a code in there, the composer is freaking genius! Well actually he is anyway, so maybe there is a code in there too.

If there would be ultimate secret code, something like to live, to err, to fall, to triumph, to recreate life out of life… would be cool.

The Solution

We asked FatShady what he thought the solution was – and he had this to say…

This is perhaps the best part, the solution is still unknown. This is the first interview of its kind and there are certainly new clues contained within the above response. While a number of clues have been laid out before you, their meaning and how these all link together has not been solved. This provides a unique opportunity for everyone reading this to get involved and help get to the bottom of it. It only takes one person to recognise a clue and the rest just falls into place.

The secrets do seem to tell a story of sorts, a journey of man through the ages from cave men to the age of discovery and onto space exploration. It also seems to relate to the progress the human race has made though science and mathematics. This is only a loose grouping of what ultimately is a vey specific riddle.

While it may seem overly complicated when you see the variety and complexity of what has already been uncovered, trust me when I say that as we started out on this journey, no-one knew what a Caesar Shift was, or the Tunguska Event, or who Piri Reis was. These have all been made through simple curiosity, research and a bit of hard work.

Everyone can contribute in some way, even if it is spreading the word about this riddle. I encourage all of you to be curious and ask questions. Join in on the conversations on the Redlynx forums and if you have an idea, even if it sounds strange, speak up.

DISCLAIMER: I must point out that I take no credit for discovering these secrets, and have only contributed a relatively small amount to solving these to date. A special thank you must be given to all of the Redynx forum members who have contributed to solving parts of this riddle over the past 18 months.

For further information or to assist in anyway, please see the below links:

Redlynx Forum, Easter Egg thread

Trials HD Secrets wiki

Thanks to FatShady for the incredible amount of work in pulling all these sources together.

Kotaku Is Hiring a PHP Developer!

Take pride in writing clean code? We’re looking for an autonomous PHP developer to join our rapidly-growing team at Allure Media. Apply within.

World of Servers