The Trials Riddle: Good Game, Squirrels, And The Letter ‘E’

Kotaku AU


It’s been a little over a month since I posted this article detailing the Trials HD riddle and what an amazing month it has been. The article received such a huge response and there was so much interest in the topic I thought I’d do a follow up just to let you know how we are progressing.

Television!

When I set out to get the word out to as many people as I could, I never imagined that it would lead to a television appearance. As you would have seen above, I have been working with the Good Game team over the past few weeks to put a story together for their show. This is the first time that the Trials HD riddle has been featured on a television show anywhere in the world and I am excited to see what comes of it. The ABC staff have been amazingly supportive of this push to get the riddle solved and I have every confidence that they will do it justice. They will be live tweeting the episode as they always do using the tag #GGTV. I will be joining in for the evening so will be available to answer questions and generally chat about where we are up to. You can follow me using @FatShadyLive. Make sure you watch the show and say hi tonight.

New Discoveries

As the main goal of this article was to get some more clues solved, I am pleased to announce that a number of new discoveries were made as a direct result of this article. I have detailed each of these below:

SKA 788 Box
In the article, there was an image of a cardboard box that we literally had no idea about. While one suggestion was that this related to the Square Kilometre Array (SKA) radio telescopes, this was not the case.

I wanted to take this opportunity to thank ‘KieranCoughlan’ for the post that solved it. Kieran immediately recognised this as a numbering sequence that was featured on a documentary about Stanley Kubrick a few years ago. The 2008 documentary detailed the 1,000 or so boxes that were left behind in Stanley Kubrick’s house after he passed away. These boxes contained a huge amount of detailed information about the various projects that Kubrick was involved in along with personal items.

As a result of your lead, a number of us watched the related documentary and even managed to capture this screen shot of the actual box. You can clearly see the attention to detail that the developer had when creating the replica. What is even more interesting about Kieran is that he is Irish and followed a link from a friend’s (Jon) Google+ feed. It was amazing to see the power of the internet reach the exact person that we needed to solve this. Thanks again guys.

As a result of this clue being solved, I even went as far as contacting the Archives and Special Collections Centre, University of the Arts London, where the Kubrick archives are now located. It turned out that the SKA number was simply used as a numbering system while the boxes were in transit to the University. Once there, the boxes were destroyed and the items catalogued. While I doubt it is relevant, there is now no way to trace this box back to its contents so we will never actually know what was inside.

One final footnote to this story was that the replica box, the one that was sent to the fans of the game as a clue, was actually a box that Kubrick himself designed. The Finnish developers went to the trouble of ordering these boxes from the UK months before they were sent out. You can learn more about the ‘Kubrick Boxes’ from this short video embedded within the companies website.

Fibonacci With Binary
For the longest time, the binary at the bottom of the Fibonacci pattern was interpreted as 10101001111 as we were told to replace the dots with the number 1 and the spaces with a zero. What ‘arete’ was able to point out was that we were missing the final zero. By identifying that there was a final zero at the end of the binary string, the number now read 101010011110 which, when converted to decimal is 2718. This is a reference to 2.718 which is the value of the mathematical constant ‘e’. This clue had been hinted at a number of times but we had never been able to piece it together. It was such an easy thing to miss and all it took was a fresh set of eyes looking at it.

We still have no idea how ‘e’ is related to the Fibonacci sequence or golden ratio but we are making progress all the same.

Squirrels!
‘Nosesquid’ was correct in pointing out that squirrels were not mentioned in the article. This was an intentional ommission as I didn’t want to get sidetracked by them. For anyone that does not know, there are more hidden squirrels in this game than there are ‘other’ easter eggs. It has always been assumed that they are related in one way or another but it was only last week that I was able to even come up with a theory about it.

When Fibonacci was writing Liber Abaci (The Book of Calculation) in 1202, he wanted to display the significance of the, as it is now known, Fibonacci sequence and its application in nature. He used the population growth of rabbits to highlight this. It is suggested that the number of squirrels in the game is a reference to this famous example about rabbits.

Unsolved Clues
While there are a number of clues that may have only been partially solved, I would be very interested to hear from any of you regarding the below.

There is a line with dots and a number 4 indicated along the line. It is thought that this is significant and that it relates to the Divine Proportion manuscript by Luca Pacioli but to date there have been no solid answers provided that connects these.

As mentioned above, we are not sure how the mathematical constant ‘e’ relates to the golden ratio in this image and would love to hear any theories about how these are connected.

Where To From Here

Well we are getting a better understanding of the riddle every week. We are also starting to pull all of the clues together. This is not the final answer but I will attempt to articulate the current thought process, for those still following this riddle.

The clues all point toward certain individuals and the significant contributions they have made toward progressing various scientific fields. Humans have never been satisfied with what we know. It is in our nature to attempt to understand what is going on around us, to go beyond our limits and to pass this accumulated knowledge on to subsequent generations. It is what sets us apart from other species.

It is with this in mind that we draw on the similarities in the clues. This is highlighted in many clues from cave paintings that show hunting methods to the earliest attempts to map the globe all the way through to Darwins observations on evolution. Many of the clues are pushing toward the single realisation that mankind has and will continue to progress. On the flip side to this optimistic view of the world is the lack of control that we actually have. A single meteorite could hit earth tomorrow and each and every one of us would perish. Looking at the clues of the Mammoth (now extinct) and the Tunguska event, it shows a much more pessimistic yet related view of the world. This all becomes all the more interesting when you realise that there are theories about how life started on this planet that involve meteors providing the ‘spark’ that started the formation of life on earth. The exact same event could bring about an end.

All of this culminates with the launch of the Voyager Golden Record. This golden record was released into space and it contained what it means to be human. In the words of Jimmy Carter directed at potential recipients of this package; “This is a present from a small, distant world, a token of our sounds, our science, our images, our music, our thoughts and our feelings. We are attempting to survive our time so we may live into yours.”

If I had to sum up this riddle as we know it right now, that would be it. We are still seeking both the question and the answer to the riddle. The Redlynx developer has suggested that there is a hint regarding the question contained within the interview tonight. Here’s hoping.

For further information or to assist in anyway, please see the below link:

There has actually been a large amount of progress made over the past 4 weeks so If you are interested, please join in on the conversation and we can bring you up to date.

Easter Egg thread [Red Lynx Forums]

Discuss

(35 Comments)
  • [–]

    FatShady

    Tuesday, August 16, 2011 at 2:05 PM

    The episode will air tonight at 8.30pm EST on ABC2. Episodes can also be streamed or downloaded at the below link:

    http://www.abc.net.au/tv/goodgame/episodes/

    Hope you like it!

  • [–]

    DAN!

    Tuesday, August 16, 2011 at 2:09 PM

    I never watch Good Game, but might have to tonight.

    Great article dewd!

  • [–]

    Blaghman

    Tuesday, August 16, 2011 at 2:14 PM

    Yay, Good to see there has been positive progress!

    I’ll still be too slack to watch GG on tv, but I’ll watch it online!

  • [–]

    Aidan

    Tuesday, August 16, 2011 at 2:23 PM

    The riddle is getting very interesting.

    Did you have any luck on the nucleotide sequences(GATCATGAC etc)?

    I remember looking it up and the protein it coded for had something to do with sodium transfer in the brain and epilepsy.

    • [–]

      lambomann007

      Tuesday, August 16, 2011 at 2:27 PM

      Hmmm, epilepsy
      http://www.youtube.com/watch?v=ux4v1PllyVw
      :P

    • [–]

      FatShady

      Tuesday, August 16, 2011 at 2:28 PM

      I still consider that to be unsolved also. That DNA has always been a painful clue for me because I was the one who realised it was DNA but since then there has been little progress.

      A number of people pointed it out as a particular sequence of protien but I am just not sure how it is related.

      The thing that gets me every time is that James Jopyce quote that was a clue in the last article. This is a clue to Craig Venter and secret messages encoded within DNA. It is also about the first 100% synthetic DNA that was made using a computer program…

      I can’t see how this clue links back to the protien. I think it is more related to the Craig Venter thingy, but just not sure which way to go… this is why I left it out of this article.

      • [–]

        Aidan

        Tuesday, August 16, 2011 at 2:33 PM

        Synthetic DNA made by a computer? That’s interesting. If I get some time I might look into that.

        • [–]

          FatShady

          Tuesday, August 16, 2011 at 2:41 PM

          It was an interesting lead, just couldn’t make anything of it..

          Here is the video where Venter announces it and I think the quote is mentioned.

          http://www.ted.com/talks/craig_venter_unveils_synthetic_life.html

          Here is some more background about the technique.

          http://io9.com/5543843/scientists-create-artificial-life-+-synthetic-dna-that-can-self+replicate

          It is important to note that this announcement was made in 2010 and after these clues were included in the game. Venter also made some announcements in 2008 (before the games release) where some coded messages were in synthetic DNA but these we using a much simpler cipher.??? No matter how hard i tried, I could not makes sense of the DNA in the game.

          I could be wrong, but this James Joyce quote seemed so specific in suggesting that the DNA was actually a coded message?

      • [–]

        Quincy

        Thursday, August 18, 2011 at 12:11 AM

        Haha I never played this game but I was intrigued (As a med & genetics student) I cross referenced the sequence CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT
        I got this from another website,
        and it seems to most closely match a part of a sodium channel protein, Unstable sodium/ion channels of course are related to epilepsy and seizure disorders

    • [–]

      Wonko

      Tuesday, August 16, 2011 at 3:36 PM

      Did you do BLASTp or BLASTn?
      With the protein blast you get hits with an E-value of around 30 for biopolymer transporter. I don’t think the protein has not much to do with the problem, more likely the context of the DNA and how it was produced and stuff.

  • [–]

    Harli

    Tuesday, August 16, 2011 at 2:24 PM

    GOOOO FATSHADY! WOO!! *waves Fatshady flag*

  • [–]

    lambomann007

    Tuesday, August 16, 2011 at 2:24 PM

    I still think the answer is 42…

  • [–]

    Michael

    Tuesday, August 16, 2011 at 2:25 PM

    RE: the boxes. Now that you know one belonged to JJ Abrams and the other to Kubrick, is there a filmmaker connection there somehow? Given the apparent space theme, could it be Star Trek/2001 related?

    The Golden Ratio is usually illustrated with an image that’s surprisingly similar to that one in the picture, as seen here (http://en.wikipedia.org/wiki/Golden_ratio) Assuming the left side to be 4 units, from the label, suggests that the right side is about 2 and a half (2.47213595), and the total is around six and a half. I don’t know if those numbers have any significane, but I’m sure someone knows.

    • [–]

      Shane

      Tuesday, August 16, 2011 at 2:52 PM

      Or maybe Kubrick has an ALIAS? Eh? Eh?

      I got nothing. This is amazing work, FS, and justifiably rewarded :)

  • [–]

    Chris

    Tuesday, August 16, 2011 at 2:40 PM

    Not sure if it helps, but the sign looks like it’s made of wood. Woodcuts are the prominent artistic style used in “De divina proportione”.

    Could nothing, but my curiosity is piked.

  • [–]

    homestarruner

    Tuesday, August 16, 2011 at 2:45 PM

    Woop, i helped get this on tv. can’t wait for tonight

  • [–]

    Jimu

    Tuesday, August 16, 2011 at 2:50 PM

    Jelly!

  • [–]

    Chuloopa

    Tuesday, August 16, 2011 at 2:53 PM

    Damn, mate.
    Gentleman and scholar much?

    You do such epic work – so stoked to see you tear up the tv tonight :D

  • [–]

    CJ

    Tuesday, August 16, 2011 at 2:54 PM

    OH so thats what all those signs with giant squirrels on them mean. How ever to me the biggest puzzel is how many more hours will it take for me to no fault Ultimate Endurance.

    • [–]

      FatShady

      Tuesday, August 16, 2011 at 3:04 PM

      Ultimate Endurance is not that hard you just gotta take your time. I mean you will have to practice each track but it is possible.

      The achievement is called Marathon for a reason. You should focus on each track and dont worry about your time, just the faults. Take each jump slow and work out a consistant wat to zero fault the track.

      When you can complete each track 80% of the time with zero faults, go for it. It took me 20+ attempts to get it and I was already a pretty decent rider and I thought i’d breeze through it.

      Also note that with one of the updates that was released a year or so ago, the tournement was modified to make it much easier. It is only 20 tracks instead of 24 and the 4 that were removed were the hardest ones. It turned out that the original tourney only have about 40 people ever complete with zero faults.

      • [–]

        CJ

        Tuesday, August 16, 2011 at 3:45 PM

        Yes that whole redux of the tournament ticked me off a little, I’ve gotten as low as 2 faults. Just a matter of trying it a little every day

  • [–]

    jamesmacusedmyhandle

    Tuesday, August 16, 2011 at 3:03 PM

    Man you doing so much work on this that there better be a FatShady skin in the next Trials game!!!!!
    Or at least guest host next time Hex or Bajo are absent…..
    Whilst it’s cool that the above clues have been worked out, do we actually know what Stanley Kubricks Squirrels means?
    Whilst that is a massive generalisation, i mean how have these revelations advanced the cause? Do we now need to find out what was in that exact box for the next clue…? Are there actual squirrels planted in the world with little usb sticks with more clues…?

  • [–]

    Jem

    Tuesday, August 16, 2011 at 3:19 PM

    re: the Divine Proportion section. If the ’4′ represents the measurement from A-B (ie the two dots) then doesn’t the Golden ratio mean that the remaining measurements are B-C equalling 2.472 and thus A-C equalling 6.472.

    No idea how that relates to ‘e’ though.

    • [–]

      FatShady

      Tuesday, August 16, 2011 at 3:24 PM

      You are right about that, I just dont think the image matches it.

      You are referring to this right?

      http://designshack.co.uk/wp-content/uploads/02-golden-ratio-math.jpg

      If you look at the image, the two sides are equal, and the dot with 4 seems to indicate a point on te line rather than the value of the side?

      I don’t know the answer so please don’t take this as negitivity, just my reason for not suggesting this so far.

  • [–]

    PuppyLicks

    Tuesday, August 16, 2011 at 3:20 PM

    Legen-

    wait for it

  • [–]

    Brendo

    Tuesday, August 16, 2011 at 4:22 PM

    Good game:
    The show for casuals, by casuals

  • [–]

    FatShady

    Tuesday, August 16, 2011 at 4:46 PM

    The episode is already available online, check out this segment..

    http://www.abc.net.au/tv/goodgame/video/default.htm?src=/tv/goodgame/video/xml/20110816_2030.xml&item=06

    Im actually really happy how it all came together. A heap of hard work but it looks really interesting. Shame they didnt plug the forums but what can you do?

    • [–]

      RodK

      Tuesday, August 16, 2011 at 6:16 PM

      Not sure if it’s been mentioned yet, but the constant e is used to determine the “golden spiral”, also known as a “fibonacci spiral” using polar equations.

      http://en.wikipedia.org/wiki/Golden_spiral

      • [–]

        FatShady

        Tuesday, August 16, 2011 at 7:10 PM

        Im not great at this stuff, can you elaborate on how e is related to the spiral. It seems that the spiral grows by phi (1.6…) at each quarter turn, but not really referencing e (2.718)…

        Can you provide more evidence to back this up to explain it a little more please.

        • [–]

          RodK

          Tuesday, August 16, 2011 at 8:01 PM

          It’s been awhile since I’ve used it, but instead of using cartesian coordinates, a spiral can be created using a simple equation using Polar Coordinates. Polar coordinates use r, the distance away from 0,0 and the angle, measured in radians.

          From what I can remember, when using e, it creates the spiral similar in shape to the fibonacci spriral, but there is an exact growth factor constant to make it exactly the same.
          Another link is:

          http://en.wikipedia.org/wiki/Logarithmic_spiral

          This shows the family of curves that use the same polar formula, with the fibonacci spiral being one distinct example of them.

          Maybe the clue is showing that the shape of some plants and animals’ evolution has followed the logarithmic spiral?

        • [–]

          z

          Saturday, April 7, 2012 at 7:18 PM

          http://en.wikipedia.org/wiki/Golden_spiral

          The “Fibonacci” spiral is effectively a special case of the logarithmic spiral.

          Also see http://en.wikipedia.org/wiki/Fibonacci_sequence and the relationship of the sequence to nature — there are some well-known results about how certain elements of mathematics can be used to model natural phenomena with a great degree of accuracy, like the arrangement of sunflower heads and other flowers. There’s some other examples of this as well, that do not involve the golden ratio and the Fibonacci sequence, too.

  • [–]

    Jhaan

    Tuesday, August 16, 2011 at 8:26 PM

    If you use the basic encoding A=1, B=2, C=3, Big Bang adds up to 42.

Join The Discussion