The Trials HD Riddle: A Look At Gaming’s Da Vinci Code

The Trials HD Riddle: A Look At Gaming’s Da Vinci Code

Most of you know Trials HD as the punishingly difficult 2D racer on Xbox LIVE Arcade – but buried deep within the impossible jumps and the incredible physics puzzles is something far more elusive – a riddle. A fiendish riddle that would make Da Vinci dribble. In this one-of-a-kind feature Kotaku reader, and Trials HD obsessive, FatShady breaks down this incredible puzzle and speaks to the creators of the game to try and uncover the intriguing mystery that is… The Trials HD Riddle.

The Beginning

But what is the Trials HD riddle? So far we have very little idea with regards to how the individual pieces hang together – but, for now, it’s a series of clues – buried deep within the tracks of Trials HD – clues that work together to create a bizarre mystery that is as yet unsolved, a series of Easter Eggs loosely tied together in a way we can’t yet fathom.

Few who play, or even finish the game in its entirety, will be aware of their existence. The clues found so far can be seen in this video.

Surprised? Even aware that these secret areas even existed in a game such as this? We asked FatShady to explain the clues one by one.

The Clues

The Fibonacci Number

This secret is a representation of the Fibonacci Sequence or the Golden Ratio. The first two Fibonacci numbers are 0 and 1, and each subsequent number is the sum of the previous two, for example, 0, 1, 1, 2, 3, 5, 8, 13, 21.

Cave Painting

This secret is thought to be a cave painting, specifically the ‘Lascaux Hunters’ from the cave paintings located in France.


Known as “the prehistoric Sistine Chapel,” the Lascaux Caves, a cave complex in south-western France, contain some of the most remarkable paleolithic cave paintings in the world, from at least 15,000 years ago. Here is a highlighted image showing the hunter pictured above.

Number 42

The number 42 is thought to be a reference to the movie ‘The Hitchhiker’s Guide to the Galaxy’ and in particular, the ‘answer to the ultimate question of life, the universe and everything’ (which of course is 42).

Interstellar Envelope

The clue here is two circles with a line connecting them.


This symbol has been identified as one part of the Interstellar envelope, a golden record that was placed on the Voyager spacecraft in 1977 and sent into space as a way of humans communicating to other intelligent life. This symbol is located in the bottom right section of the record. While it is not currently known how this image relates to the riddle, it has been suggested that this record has something in common with Leonardo Da Vinci’s notebook.


As it relates to the record, this diagram illustrates the two lowest states of the hydrogen atom. The vertical lines with dots indicate the spin moments of the proton and electron. The transition time from one state to the other provides the fundamental clock reference used in all the cover diagrams and decoded pictures.

1452

Given that Leonardo Da Vinci features elsewhere within this riddle, these numbers are thought to represent the year that Da Vinci was born.

Flapping Wing

This image shows a hand-like mechanical structure. This is thought to be a representation of a sketch made by Leonardo Da Vinci.


Here is the original sketch made by Leonardo Da Vinci depicting the flapping wing. This image can be found within the book ‘Leonardo’s Notebooks’.

De Divina Proportione
There are two secrets that are provided here. Only when they are combined do they reveal the answer.

D__I _IN___OPO__ION_


_ED_V__APR___RT___E


DE DIVINA PROPORTIONE

This translates to “The Divine Proportion”, a manuscript by Luca Pacioli which concerns mathematical proportion and the golden ratio.

While the title of the text has been discovered, it seems that the more relevant clue here is the line with dots, along with the number 4 representing a certain part of this image. It is not currently known how this text relates to this image, or more importantly how it relates to the overall riddle.

Fibonacci Pattern with Binary

The Fibonacci pattern is again shown here. This secret is special however because in addition to the image, it shows a series of dots below the image. Clues have been provided to suggest that the dots at the bottom of this image are actually binary code (dot = 1, space = 0). It reads 10101001111.

As this is the image of the Fibonacci pattern shown above, has the binary code been reversed? It is not clear exactly what this means. What does this clue signify?

Orion Constellation

This secret is located on the level ‘Space Station’. Therefore this image is thought to be of a constellation.


These stars represent the Orion Constellation. The three stars in the middle being Orion’s belt. The Orion constellation is also known as the hunter. It can also be viewed from within the Great Pyramid in Egypt via a small shaft. This however (considering the responses below), may be a reference to the Orion Spacecraft, which is a current initiative of NASA to explore deeper into space that we have gone before.

Roman Numerals

The numbers read: 3-18-15-1-20-15-1-14

If those numbers were deciphered using a simple Alpha-Numeric Substitution Cipher (ie, a=1, b=2,c=3), they spell out the word “Croatoan”.

There is a story of a ‘lost colony’ who carved the word “Croatoan” into a tree in the settlement of Roanoke. This was the only clue given to the group’s leader, John White, after he left back to England to get supplies. The English government officially declared the colony of Roanoke “lost” in 1597. It has since, however, been proven by DNA analysis that the missing settlers/colonists were integrated into the Croatoan Tribe living south of Roanoke.

Darwin’s Tree of Life

Charles Darwin is commonly known for his revolutionary theory of evolution, which would be documented in his work titled ‘On the Origin of Species’. During the 20 years he worked on this, he kept a number of notebooks. In one of them, from approximately 1837, he sketched the following to describe the evolutionary process.


On a side note, knowing what we do about the theory of evolution and how revolutionary it is, I like that even Darwin writes ‘I think’ above this image suggesting this idea was in its infancy.

Cardboard Boxes

There are two boxes represented in this image.


The box on the left has been identified. It is a recreation of a ‘Tannen’s Magic Mystery Box’. What is more interesting about this box however is its owner, JJ Abrams (Lost, Fringe, Mission impossible 3). It turns out that Mr Abrams was the guest editor of the April 2009 edition of Wired magazine. This magazine had a large number of puzzles hidden within its pages. It turned out that the puzzles all linked together to form a larger riddle (sound familiar yet?). As these two boxes are located in very close proximity, it is thought that they are connected.


The box on the right of the image however is a complete mystery. The box is cardboard with packing tape over it. It has the writing SU-122 crossed out and below it is the writing SKA-788. In order to progress this riddle, the game developers sent a package out to a fan of the game that was a recreation of the box. This recreation was said to hold a clue to what the box was. Inside the box was a 6.2m panorama that is made up of a series of street view images taken from Commercial Street in London. This street is famous for the Jack the Ripper murders.

Binary Co-ordinates

The binary code reads 1011110100111 N, 10011110101101 E

To decipher this one, first binary was converted to decimal, then the decimal outcome was converted to Longitude and Latitude. The result was 60° 32′ 59.9994″, 101° 34′ 11.9994″ which is a location in the middle of Russia.


Further investigation resulted in the discovery of the Tunguska Event. This was the site of a massive natural explosion that occurred in 1908. The explosion is believed to have been caused by the air burst of a large meteoroid or comet fragment at an altitude of 5–10 kilometres (3–6 mi) above the Earth’s surface. The explosion is thought to have knocked down an estimated 80 million trees.

DNA Sequence

This is thought to represent DNA because of the letters used representing the 4 building blocks of DNA (Adenine, Cytosine, Guanine, Thymine).

The letters are thought to read CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT however the image is difficult to read in parts. There are 40 letters in total.

The Map

The clue is a map of the world with a piece missing. This map shows rhumb lines radiating from a circular pattern of wind roses or compass roses which indicate various winds and compass directions. This is common in Portolan charts of the 1500’s.


The missing piece of the map is known as the Piri Reis Map. This map was created in 1513 but was only rediscovered in 1929. Like other portolan charts of the time, the Piri Reis Map exhibits a network of rhumb lines and compass roses. This is the only surviving remnant of what was thought to be a much larger map.

Mammoth

So far, this is just a Mammoth, an extinct relative of modern day elephants. It is not clear what significance this mammoth has to the overall riddle. Could it relate to the modern discovery of a frozen mammoth, or the work currently underway to map the DNA and potentially clone the mammoth? No-one knows?

Speaking To The Creators

In an attempt to dig deeper into this riddle, FatShady spoke to Redlynx Developer ANBA, who not only was heavily involved in the development of Trials HD, but created this riddle. Here is what he had to say.

For the record, what is your real name and title?
I am Antti Ilvessuo, Creative Director and Co-Founder of RedLynx. In the forums my tag is ANBA, and on the office wrestling mat, my nickname is “The Dreadnaught,” because I am like the old naval battleships, large and obsolete.

Where did the inspiration come from to create such a complex Easter egg hunt?
Always when watching movies or TV series I’ve been more interested in the backstory and world rather than the current plot itself. In my mind, it creates a deeper feeling and interest toward the “product”. And about Easter eggs, they are in my mind more than that, since Easter eggs are usually just fun, goofy stuff. These are secrets that have “meaning.”

Something like Lost had a lot of pretty good stuff that really pointed out the way that things have been thought in the background. Of course I was not a big fan of the ending, but the journey of watching Lost was a fun one. Maybe that was the meaning of the series, I don’t know.

Also I think the Lord of the Rings had some influence on this. I’m not a big fan of the book in the way that people usually are, more like I think it’s just awesome that there is a real history behind the books and events there, not just a made up slice of the universe.

It has been 18 months since the game was released and while progress has been made, no one has solved the riddle. Do you consider an unresolved riddle a success or a failure?
Success definitely, both personally for myself and for the people that are looking to solve it. If it would have been nailed in first day…what good is that? Many small details would have been lost, some small information or interesting facts. Nobody would have found those. Some missteps could not have been taken, but those always are good. You learn and your imagination and desire to know would have not been tickled. All lost forever. So no, unsolved riddles are not failures, not at all.

Are you concerned that this riddle will never be solved?
No. 😉

How hard has it been to keep this secret to yourself for so long? Does anyone else know the answer?
Not hard. Most people don’t even know that it’s there. Some know it’s there, but they know I won’t say anything. Our P.R. director knows the answer – I told him because if a meteor hit me, the answer would be lost forever!

That might sound like a strange fear, but meteors come close to Earth all of the time. I have instructed my IT guys to set up a screen in the office that constantly monitors all meteors and near-Earth objects at all time, using the data from this NASA website.

Finland is known as the land of 100,000 lakes, and I fear that another will be created by falling meteor. If it should land on me, they can call it Lake Antti.

The most common question I hear is from people who don’t even know what they are looking for. For example, is the riddle a phrase, a movie title, a poem, a person? What clue/s would you say hold the ‘key’ to linking the clues together and finally solving this riddle?
There are two things. What is the question AND what do the things that have been found so far mean? Right now, people stop when something is confirmed maybe just too bit early. And hmm, as to the question. Well maybe there is hint in this answer?

They stop and don’t seem to think about the combination of all things and what they could mean. Like the map, you found part of it but then what? How could we have a map that is not found? What is the map that we have?

Finally, has any clue been missed or ‘solved’ incorrectly? Would like to correct/point us in the right direction?
There was a box that was opened. It said, “Don’t open it!” so that was a turn in the wrong direction. Maybe the box would be more meaningful if it were closed, not opened.

But otherwise it’s all been pretty much good. Hmm, regarding Ode to Joy: the notes are from the song, but they don’t form code. If they would have made been in code, that would have been really awesome. Or maybe there is code in Ode to Joy actually, but that was not the meaning. But if there is a code in there, the composer is freaking genius! Well actually he is anyway, so maybe there is a code in there too.

If there would be ultimate secret code, something like to live, to err, to fall, to triumph, to recreate life out of life… would be cool.

The Solution

We asked FatShady what he thought the solution was – and he had this to say…

This is perhaps the best part, the solution is still unknown. This is the first interview of its kind and there are certainly new clues contained within the above response. While a number of clues have been laid out before you, their meaning and how these all link together has not been solved. This provides a unique opportunity for everyone reading this to get involved and help get to the bottom of it. It only takes one person to recognise a clue and the rest just falls into place.

The secrets do seem to tell a story of sorts, a journey of man through the ages from cave men to the age of discovery and onto space exploration. It also seems to relate to the progress the human race has made though science and mathematics. This is only a loose grouping of what ultimately is a vey specific riddle.

While it may seem overly complicated when you see the variety and complexity of what has already been uncovered, trust me when I say that as we started out on this journey, no-one knew what a Caesar Shift was, or the Tunguska Event, or who Piri Reis was. These have all been made through simple curiosity, research and a bit of hard work.

Everyone can contribute in some way, even if it is spreading the word about this riddle. I encourage all of you to be curious and ask questions. Join in on the conversations on the Redlynx forums and if you have an idea, even if it sounds strange, speak up.

DISCLAIMER: I must point out that I take no credit for discovering these secrets, and have only contributed a relatively small amount to solving these to date. A special thank you must be given to all of the Redynx forum members who have contributed to solving parts of this riddle over the past 18 months.

For further information or to assist in anyway, please see the below links:

Redlynx Forum, Easter Egg thread

Trials HD Secrets wiki

Thanks to FatShady for the incredible amount of work in pulling all these sources together.

Comments

    • it was me… i admit it. i ‘opened’ the ‘do not open’ box… cant undo the past. that has to be the worst part of life… the absolution of past.

  • Epic work Fatshady, my mind boggles at the work that’s gone into investigating these.

    Have any other game creators ever done such a complex series of easter eggs? The amount of time and effort that must have gone into implementing these in the game… craziness.

  • Random thought – what do we know about the rider of the bike? They’re always wearing a helmet, so what is behind the visor? And what is their purpose for doing all this crazy riding? Perhaps the clues answer these questions in some way…

  • ‘There was a box that was opened. It said, “Don’t open it!” so that was a turn in the wrong direction. Maybe the box would be more meaningful if it were closed, not opened.’

    Reference to Pandora’s Box?

    • The box with the question mark is a box that JJ Abrams has.. He game a talk on TED (http://www.ted.com/talks/j_j_abrams_mystery_box.html) and in this he explains that he has a box that he has not opened since childhood. He said that the mystery was more valuable to him than actually opening the box.. The mystery made it special.

      I think what ANBA was referring to was that the box he sent to the fan of the game could have been solved without actually opening it. So in a way, ANBA wanted to create something special for this fan, never really knowing what it was. I dont think we ruined anything, but some of the mystery has gone…

      Dont let me stop you investigating that though?

    • no, it was a reference to my box which was a tannens mystery box mock up. i earned it from the devs and it specifically said do not open. of course the axxhole i am, i opened it. inside were 3 magic books. (later we were told that the contents of the box didnt necesarily relate to the overallriddle but served as clues about the boxes. you can watch the video of me opening the box and displaying the contents on youtube
      redlynx secret box prize.
      the books are quite interesting and expensive.

  • Holy Fiddlesticks, that was awesome, great work FatShady! As for the puzzle.. er… um… mmm… Quick, look the answer is behind you.
    *jumps out the nearest window*

    • I had spotted that I think but while freaky I made nothing of it… Anyone else can elaborate please do.

      • Jack the Ripper sent a police officer (?) a cardboard box containing part of a wine-soaked human kidney, along with the ‘From Hell’ letters…

    • Except if he was going to add that it it will have to be the pop culture meaning for 666. because the original ‘devil’s number’ is 616.

  • WTF!
    I had a hard enough time finishing the tracks without noticing the background.

    Well done to anyone who even noticed there was a riddle at all.

    • **just one more turn
      **last attempt
      **ONE MORE HONEY
      **I’M COMING … geez
      **GIMME A SEC!!!!
      **IM NOT HUNGRY
      **Ill be in soon
      **There’s no way you’ll ge it bro, Ive been trying for hours
      **How’d you do that?
      **I hate you

  • Woah….

    I’d love to help, but it took my entire lunch break to read through all of that, and i went cross eyed.

    This is COMPLETELY beyond me.

    Absolutely EXCELLENT work though, mate 🙂

  • lol, and I thought this game was something else entirely.

    Excellent write up and interview FatShady, I am really curious to find out what the answer is after this amazing lead up..

  • That was insane. So much detail. Great work FatShady! Is this only on XBLA? I might have to invest in another 360 to try games like this out.

  • Oh well done FatShady! You can tell you’ve put a lot thought and work into this.
    I wasn’t interested beyond mild curiosity before but now you’ve got me thinking about it.

  • Such an awesome read. The Answer? I am going to say … its a recipe for a delicious sour dough bread with cheese and mammoth juice.

  • Awesome awesome job Fats!

    I’m gonna be a bit of a party pooper now though and query – why have a riddle involving these elements in a game about a dude riding a motorbike? I love the idea of it and all but, these things seem totally disconnected from this kind of game. /end negative response

    • I’m not having a dig at you at all Fats, I think you’ve done a seriously amazing job with all this! I’m just wondering how all this will relate to a mtorobike rider… maybe the answer makes that more clear?

      • Its all good man.

        I dont think it has anything to do with the bike. I just think that ANBA was having a laugh and thought this would be a cool idea.

  • So fantastic to see this article put up here!! Here’s hoping someone comes up with some cool ideas and new paths to try!

    I give a massive pat on the back to the god of a man, FatShady. The amount of time he has sweated on this is freaking amazing! Congrats man!

      • When condensing so much information into written form it’s expected that a couple of mistakes would make it into the works 😉

    • Why is everyone stopping at a pop culture reference with 42? Not in tone with everything else. Try these maybe?

      * Given 27 same-size cubes whose nominal values progress from 1 to 27, a 3×3×3 magic cube can be constructed such that every row, column, and corridor, and every diagonal passing through the center, comprises 3 cubes whose sum of values is 42.

      * Forty-two is a pronic number and an abundant number; its prime factorization 2 · 3 · 7 makes it the second sphenic number and also the second of the form { 2 · 3 · r }. As with all sphenic numbers of this form, the aliquot sum is abundant by 12. 42 is also the second sphenic number to be bracketed by twin primes; 30 is also a pronic number and also rests between two primes. 42 has a 14 member aliquot sequence 42, 54, 66, 78, 90, 144, 259, 45, 33, 15, 9, 4, 3, 1, 0 and is itself part of the aliquot sequence commencing with the first sphenic number 30. Further, 42 is the 10th member of the 3-aliquot tree.

      * 42 is the product of the first three terms of Sylvester’s sequence; like the first five such numbers it is also a primary pseudoperfect number.

      * It is the sum of the totient function for the first eleven integers.

      * It is a Catalan number. Consequently; 42 is the number of noncrossing partitions of a set of five elements, the number of triangulations of a heptagon, the number of rooted ordered binary trees with six leaves, the number of ways in which five pairs of nested parentheses can be arranged, etc.

      * It is the reciprocal of the sixth Bernoulli number.

      * It is conjectured to be the scaling factor in the leading order term of the “sixth moment of the Riemann zeta function”. In particular, Conrey & Ghosh have conjectured

      {1 \over T}\int_0^T \left| \zeta\left({1 \over 2} + it\right) \right|^6\,dt \sim {42 \over 9!}\prod_p \left\{1-{1\over p}\right\}^4 \left( 1 + {4 \over p} + {1 \over p^2} \right) \log^9 T,
      where the infinite product is over all prime numbers, p.[1][2]

      * It is the third pentadecagonal number. It is a meandric number and an open meandric number.

      * 42 is a Størmer number.

      * 42 is a perfect score on the USA Math Olympiad (USAMO)[3] and International Mathematical Olympiad (IMO).[4]

      * In base 10, this number is a Harshad number and a self number, while it is a repdigit in base 4 (as 222).

      (thanks wikipedia!)

  • I’d just like to point out Annti suggests not all the clues have been found and at least one may have been interretted the wrong way. In the case of the box, I’d suggest working out ewhat the original marking was before it was resealed.

    • The way i read it he says all clues have been found. What quote are you referring to?

      The markings were SU-122 crossed out with SKA-788 in its place.

      • He was probably referring to this part of his response, I believe: “What is the question AND what do the things that have been found so far mean?”.

  • One other thing, ANBA is known for giving clues in his responses. I found this last week but have not made anything much of it yet…

    He said “to live, to err, to fall, to triumph, to recreate life out of life”, which is actually a quote that was hidden in the first ever synthesised DNA sequence.

    http://www.ted.com/talks/craig_venter_unveils_synthetic_life.html

    This is the presentation that gives detail to the cipher used. What I was thinking was that the DNA above can be cracked using the same cipher that was used to encode the DNA sequence.

    • I’ve done a bit of searching around this, and spent a good deal of time trying to put it together, but I can’t see anything useful. Any chance there are other images of that sequence? Some of the letters I’m not too sure about.

    • I think the question is…
      What do you do when you fall off the bike?
      And the answer would be…
      Try and try again…

      Explains a few things, darwinian evolution, da vincis attempts at flying, the remapping of the world, the trips to the moon…
      More than likely wrong but cant hurt to have a stab…

  • Amazing. Great to see this level of depth in the game, and in the efforts of those determined to solve the riddle!

    Great article!

  • Think I found one, possibly two of those clues on my own, had no idea they were all connected to one large riddle!!

    Such great work by devs to create such an awesome riddle!

  • Orion was known as the hunter and was usually depicted with a bow and arrow, right? Could there be a connection between that and the cave drawing that seems to an archer hunting some sort of cow or horse?

    • Also, the symbol on the “divine proportion” picture could possibly be a representation of a water molecule… Or I guess any number of other compounds. I also have no idea how the number 4 connects to it

      • I was thinking more of a maths problem myself. Like this is plotting points on a numerical line and the 4 with the dot indicates that number in question?? We have no idea.

        If you can find any evidence of this that would be cool.

        • Perhaps the dots are Morse code? Which would show ‘S’ and ‘H’. This wouldn’t explain the spacings, though.

        • I tried the chemistry idea, but what throws me off is that there’s a circle around the two outside dots. If they wanted this to be water, they would’ve put a circle only around the middle dot, representing the valence shell.

          I’m thinking, what if you put all the clues in chronological order (somehow. The backwards Fibonacci, the 42, and the map might be ambiguous.), and then count off 4? The 4th or 5th clue might reveal something.

          • Nice. I thought it would be a phinary number. That actually led me to an object on the list of Near Earth Objects. It would have fit the riddle just perfectly but it was just a coincidence as I misinterpreted the data.
            The Object I found was minor planet Khufu. Named after the constructor of the Great Pyramid of Giza. It would have connected to both the Orion egg and ANBAs hint of near earth objects… And besides that interpreting the binary under the golden cut spiral as Phinary would have connected to other universal language hints.

            I think you all should look at the near earth objects more closely!

          • don’t know if this has anything to do with it but i think on that box an su 122 was a mobile howitzer sort of thing during world war II so maybe the box has some relation to that.

    • As for Orion, you are right, it is known as the hunter. I suspect it is however a closer match to the cave painting than the constellation, as the images I found of Orion are not similar to the cave paintings… but it could be related.

  • Wolfram|Alpha seems to think that the sequence is SCNN1A. Can anyone with a medical textbook help us figure out what that is exactly? All I can really find is that it’s in people, mice, cattle and chimpanzees.

    • It seems to be partly responsible for producing this protein: http://en.wikipedia.org/wiki/Nav1.1

      Something to do with sodium transfer in the brain, or something. The article also mentions that it has to do with epilepsy.

      It sounds a little obscure to be relevant, though. Are they sure that’s the right gene?

  • SCNN1A is what I found as well and is “slightly” better documented in the Secrets Wiki.

  • This is incredible, FatShady – thanks for posting it.

    A fascinating riddle, I generally love things like this 🙂 It’s almost reminiscent of some of the meta-gaming with the symbols in Assassins Creed, for example.

    Not much that can be made from this, though – like the article suggested, it’s very difficult to find the answer when you don’t even know the question yet.

    Has anyone tried running the DNA sequences into the human genome project, or seeing if they code for a particular animal gene?

    40 letters in total seems odd, though, because codons (and genes) are in blocks of three nucleotides. Perhaps it’s not a genetic reference at all?

    • There is a clue in the interview that links to the use of DNA letters as a form of cipher. Noone has cracked it, but that is what im thinking. This is also likely to be the reason for there being 40 letters.

  • This riddle seems pretty fascinating, and it was great to get a sampling here. Thanks FatShady!

    The interview was particularly interesting. Getting some of this stuff in his words definitely changed my perspective on the whole thing. (I’ll admit, I wasn’t really all that curious when FatShady previously mentioned the Trials HD riddle. But now my perspective is quite different.)

    It definitely feels like there are clues in his responses. All that talk of meteors, and even a link to an external website, definitely feels like he is hinting at something. Or maybe he is just having some fun.

    As an aside from the topic, why does FatShady’s name appear so many times in the article? I thought the article was by him? Strange third-person speech confused me. (I’m assuming there are missing italics, much like under the last heading…)

    • I felt that so much of it was FatShady’s work that it really should be his name in the byline.

  • Truly excellent job Shady. Anyone wanting a LONG read on the subject should really get over to the Easter egg thread on the Redlynx/Trials HD forums.

  • Wow. Just WOW
    I’ve not played or seen this game before, but I hear so much about it I’ve always sort of kept it in the memory banks. This has me VERY intrigued now. I have a few things to contribute to you, that may change a few interpretations…

    Firstly Chumly mentioned Schrodinger’s Cat, a well known riddle, basically ponders that if you seal a live cat in an airtight soundproof box, is it alive or dead… well, that’s wrong but as base as I can put it…

    Then I got to thinking of Darwins tree of evolution which began slowly (one thought is due to a meteor that brought base life to earth) and has exponentially grown since, and also been impeded by meteors on at least one occassion (sorry dinosaurs, you are missed) 🙁

    Back to Schrodingers cat (is that thing still here?)
    The Cracks mentioned that :”Also, on the cardboard box, 788 – 122 = 666″ which is believed to be the devils number (perhaps hell? is the cat dead physically and alive in hell?)

    Right, so continuing on, are you with me? NO. Great

    So far we have evolution, life, death, hell…

    Onto the Fibonacci numbers. I don’t think this clue is about the numbers as much as it is exponential growth. I.e the more you have the faster it grows. Typically there is a point reached where it is forced to stop by an outside force, like say, a meteor?

    Moving on. 42. A few things here.

    1- It is the meaning of life in The Hitchikers Guide…. but also relates to alot of other important things, thanks for the pointer Mr Freeze Icequire

    2- As noted, Leonardo De Vinci was born in 1452, which contains the numbers 4&2

    3- The Divine Proportion clue was 3 circles with 2 lines, and the number 4. I’m guessing the missing number is 2 but I know not how else this clue fits in, perhaps it’s a guide to the right line of thinking.

    Moving onto Orion the archer and the Croatoan paintings. Perhaps this is to demonstrate the growth of humanitys perception. The evolution of cave paintings to the application of said paintings in the sky. Again, it may not be about the picture, as what it has to say.

    My last clue for now, and without playing the game or researching further is that the next Trials game was subtitled evolution… I don’t know what it means, but I hope I have helped in some way.

    • I forgot to mention that The Divine Proportion was also described as having a golden ratio, which linked my thinking of 42 to the other mathematical uses it has.

      Also, I know I didn’t include some of the clues, so maybe they are what will prove me wrong, but mainly I just haven’t figured out how they fit in yet 🙂

      Oh, speaking of which, maybe the mammoth references link the meteors to life and death, but also the fact that what we once hunted for food (and likely feared to face) we now near being able to create and control with very little to fear…

      • I love how much this got you thinking. I am really sorry I couldn’t contribute to this thread the day it was posted as I was working (jobs huh?). Your level of crazy brain dumping is what this has been like for over a year now. It was nice to see that it got that much interest out of you mate.

        Thanks

  • Still thinking. Getting late, words not working, sleep…
    The cave paintings depict man hunting dear, but again maybe the picture itself is trying to say something else. Like, man drew himself hunting (mammoth) on the ground, but in the sky we have not a mammoth to hunt… maybe that’s coming? Is it alive or is it dead already (schrodinger’s cat)?? Is there life apart from our own??? Maybe that’s the riddle and the answer. I’m dying to know what you think internetzzzzzzzzzz

  • Is this not a tribute to William Pollard?

    “Without change there is no innovation, creativity or incentive. Those who initiate change will have a better opportunity to manage the change that is inevitable.”

  • FatShady – My friend Kieran came up with this: is it possible that the cardboard box is related to the Stanley Kubrick Archives which are located in London? The naming convention for the boxes is the same, ie SKA-NUMBER.

    A film-maker made a documentary about the content of one of the boxes, SKA-63. In this interview, the film-maker mentions the contents of one of the other boxes they saw while they were investigating box 63:

    “One of the most surprising things was the amount of things Kubrick kept and how meticulous he was. We saw a collection of photos of every front door on a long street in East London that Kubrick asked to be photographed so he could find the right front door for Eyes Wide Shut.”

    Sounds pretty familiar right?

    Maybe Box SKA-788 in the archive is significant?

    There’s a documentary about the archive by Jon Ronson:
    http://www.imdb.com/title/tt1263704/

    and there’s also been a book.

    Hope that’s helpful (or at least interesting!)

    • See below, it was very interesting and i loved the push in the right direction you game. thanks.

  • I know what the SKA-788 box is. It is one of the director Stanley Kubrick’s archive boxes.

    Kubrick was meticulous in his research and equally meticulous in archiving that material. His boxes are now in the London College of Communication.

    Once the director had a photographer go along Commercial Road in London taking photos of the whole street from the top of a large ladder to create a panorama. See here: http://talentdevelop.com/1554/creative-obsessions-adam-savage-and-stanley-kubrick/

    Clearly this is what the clue refers to.

    Check the brilliantly entertaining and informative documentary ‘Stanley Kubrick’s Boxes’ by Jon Ronson some time if you get a chance.

    • I watched that doco and loved it. Thank you so much for your work mate. It was exactly what we were looking for.

      If you watch the documentary again, right at the end, the specific box, SKA 788 with some scribbled out text, is sitting on the boot of a car while being packed up. It will bring a huge smile to your face and a sigh of relief from those tracking these all down.

      Thanks again!

  • My thoughts are that perhaps the game is simply quoting references to the things that made it possible? Social and scientific breakthroughs throughout the age of man.

    From something as simple as the Fibonacci sequence to da Vinci’s sketched about flight. Without all the discoveries, the game would not exist. Kind of thing.

    Maybe the answer to the riddle is the game itself?

  • Another thought. Does the NASA website linked list any information about the Tenguska meteor? Or meteors that have stuck close by that location. Or maybe even close by RedLynx HQ?

  • Here’s some progress for you on the DNA side!

    It’s pretty easy to find what the DNA sequence is – even if the image is too blurry to dindhere’s a comparison to a vast database of known sequence fragments: http://blast.ncbi.nlm.nih.gov/Blast.cgi#239740370

    The sequence is almost certain to be a fragment of the gene SCNN1A. It is absurdly unlikely that this gene is such a good match by chance (ie., from a random string of letters), and the sequence seems to be pretty specific to SCNN1A

    So waht is SCNN1A? This gene encodes a “amiloride-sensitive sodium channel subunit”. This is a protein helps regulate the flow of sodium in various membranes around the body. Here’s a nice summary from http://www.genecards.org/cgi-bin/carddisp.pl?gene=SCNN1A – “Controls the reabsorption of sodium in kidney, colon, lung and sweat glands. Also plays a role in taste perception.”

    So, what does that tell us about the puzzle? Well, I doubt the authors of the puzzle were really interested in the biochemistry of sweat or urine generation (that’s the kidney thing, and the main drawback of mutations in SCNN1a is loss of salt via the kidney). Maybe taste perception? The Zucker lab at Columbia (a colleague, in a roundabout sort of a way) recently published a paper showing that SCNN1A (called ENaCα, for Epithelial Sodium Channel) is necessary in mice for the taste of salt. MMM, salt!

    I don’t find any reference to salt in the rest of the puzzle, though (the only chemistry being hydrogen?) so I’m at a loss. But here’s what I think:

    There are lots of references to Da Vinci. And googling SCNN1A for a while turned up a page referring to the gene SCN1A (note the N!) which is a totally different gene but an easy typo to make. What is SCN1A? It’s another sodium channel, this time a voltage-gated sodium channel that is expressed in a wide variety of neurons (including taste receptors, which may have led to the confusion). What is the main phenotype of a mutation in SCN1A? According to [1], “generalised epilepsy with febrile seizures”!

    So, epilepsy! Who had epilepsy? Da Vinci!
    http://en.wikipedia.org/wiki/List_of_people_with_epilepsy

    Where to from here? I have no idea. More generally, there is perhaps a common thread of mental illness running through the whole thing: Da vinci – epilepsy. Henry Cavendish (who made hydrogen for the first time) was possibly autistic (but [2]!) Darwin wasn’t really mentally ill, although he did develop the genetic basis of hereditary disease.

    -Alex, who will now return to finishing up his Ph.D. on something completely different.

    [1] http://www.nature.com/ncb/journal/v6/n11/fig_tab/ncb1104-1039_T1.html
    [2] “There is unfortunately a sort of cottage industry of finding that everyone has Asperger’s. – Fred Volkmar

  • What I see is a bunch of various clues all related to the evolution of the species.

    Trials Evolution comes out soon.

    Connection? Surely not.

  • No mention of squirrels, in the whole article?
    Never played the game, but they seem to have a be a big part of it, at least according to the wiki, popping up near the easter egg rooms and sometimes all on their own, watching the player from hidden crevices.
    What’s interesting is that throughout the Hitchhiker’s Guide series, mice have a prominent role, having been the ones who commissioned the Earth as a giant supercomputer, and proceeded to ensure its proper execution by manifesting as little furry things and proceeding to secretly guide human development.
    By way of parallel, whatever ties all the clues together, my guess is that involves some kind of scheme by those sneaky little bucktoothed creatures.

  • In regards to the SKA-788 clue, I was reading The Age newspaper and came across an article detailing plans to possibly build a $2 billion Square Kilometre Array (SKA) radio telescope in Australia. Apparently the project involves 20 countries and when completed will be the most powerful radio telescope in the world.
    This seems to fit in with a lot of the other clues as well. Except I’m not sure how the ‘788’ fits into it

    • Sorry but this one was already solved. It relates to a large number of boxes that Stanley Kubrick had. He classified them by SKA-XXX.

      • I watched an incredible documentary about Kubrick’s boxes. Shit was insane. He was insane.

      • Thanks, I realised I made a mistake on that one.
        I forgot about the Commercial road photos that were in the box obvs. pointing us to Kubrick.
        Just to clarify, the clue is Kubrick’s box marked SKA-788, and not the contents of the box sent from the game producers, yes? If that’s the case then it’s inconsequential what relevance Commercial Rd might have in the puzzle

        • Yeah Kubrick’s box was the answer. It turns out that the dev even went to the exact company that customer built Kubricks boxes and ordered two of them. These boxes were the two sent to the guys as clues.

          • Just adding one final note to this Kubrick thing. I actually made contact with the university in Londaon that now manages the Kubrick Archives. The box number SKA788 was a reference number used in transporting the boxes to the archice (SKA = Stanley Kubrick Archives).

            The box has since been catalogued and as a result, the contents of that box may not be known. All of the boxes were stored elsewhere and there is no record of any cross reference between the SKA code and the items current location.

            It does not matter, this clue was most likely just a clue to Kubrick and perhaps one of his movies rather than the box itself being super important.

  • This would go down a treat on abovetopsecret.com!

    They dabble in all sorts of conspiracy theories and interesting stuff like the Piri Reis map.

    God that sounded like an ad…

    Not sure if this is helping but possibly asking around in conspiracy circles might possibly maybe lead to something??

    I dunno. It was just a thought but I’m rivetted by this whole thing!

  • To me, a lot of these look like they’re related to evolution somehow.

    Regarding 42, it is the atomic number for molybdenum. It’s an extremely important chemical when considering the formation of life on earth (evolution appears to be all through this) because eukaryotic life (organisms which have cells that have a membrane and nucleus, i.e. complex life) can’t fixate nitrogen from the environment, and have to rely on prokaryotic bacteria, who use it as part of the chemical process of nitrogen fixation. As more oxygen became dissolved in the early seas, it dissolved molybdenum in the minerals of the sea floor which made it available for use by those simple bacteria which could then be used by the more complex organisms to grow and evolve into complex life.

  • “That might sound like a strange fear, but meteors come close to Earth all of the time. I have instructed my IT guys to set up a screen in the office that constantly monitors all meteors and near-Earth objects at all time, using the data from this NASA website.

    Finland is known as the land of 100,000 lakes, and I fear that another will be created by falling meteor. If it should land on me, they can call it Lake Antti.”

    What an odd thing to say in the middle of an interview. Seems a little out-of-place, doesnt it? Throw that little rant in with the Hitchhikers reference (also, Kotaku, “a reference to the movie ‘The Hitchhiker’s Guide to the Galaxy’”?! Are you fucking mad???), and I tend to think it may be a reference to the HHGTTG – specifically something around Slartibartfast and Fjords – that might point to something else…

    Now, the box. The only thought I had that hasnt been mentioned is that Kubrick seemed to be a little obsessive-compulsive (thus the panorama of Commercial St to pick a door. Not a clue in itself, but a very solid hint when combined with ska788). I have no idea how that ties in, but it might have something to do with OCD type issues? I saw someone else mentioned Da Vinci had epilepsy, anyone care to google and find correlations between OCD and epilepsy?

    Finally, I completely agree with all mentions of the cave painting and Orion. Flip either image, and the two hunters seem to marry well enough in terms of shape and pose. Not exact, but certainly similar enough to mention. Something here?

    Great work Shady et al. You OCD freaks are far too good at this stuff 🙂

  • I think were looking to hard and to deep, we need to look at the bigger picture and try to make sense and relation of the current clues

  • OCD is uncommon (some would say rare) in people with epilepsy, but there does seem to be a connection. OCD is seen most often in those with complex partial seizures originating in the temporal or frontal lobe, or seizures originating in the anterior cingulate gyrus, near the corpus callosum.

    Although it is unclear why OCD tends to occur with epilepsy, evidence of the association is quite convincing. Early studies suggested that epilepsy caused certain personality characteristics to develop, including obsessional traits. Some evidence suggested an increased likelihood of a general personality disorder in epilepsy. Others found that different types of epilepsy may be associated with different forms of abnormal thinking or behavior. A well-known article by Waxman and Geschwind (1975) suggested that temporal lobe epilepsy could be linked to a specific behavioral syndrome. Obsessional traits were described as an additional component of this syndrome. Many have felt that symptoms of OCD might occur as a result of generalized personality factors associated with epilepsy.

    So as you see there is a small relation and also a total difference between OCd and Epilepsy. And at the current moment I am researching Davinci,’s medical history and status

  • Unless i missed something in all the comments, no one thoroughly addressed SU-122, only the SKA-788.

    i might be on the wrong track, but SU-122 was a Soviet Tank in WWII
    http://en.wikipedia.org/wiki/SU-122

    I find it interesting, only because at the start of the interview, he refers to himself as “the Dreadnaught”, named after the old naval battleships.

    Are Anitque War Machines relevent at all?

    Or does Kubricks original box also have SU-122 crossed out, proving my above rambling irrelevant?

    • Yeah when you watch the box regarding Stanley Kubricks archives, you see that SU122 was actually on the box so this tank reference is simply misleading. Thanks for getting back to us though.

  • the second Fibonacci pattern with the binary code. directly translated it is a copyright symbol. 10101001111 – ©

    On Good Game (ABC) the creator gave a questionable clue that the clues are compiled as a question and answer. 

  • I would be great if a solution is found and it is not a chicken and egg goose chase. maybe Evolution will hold more clues.

  • If I can throw in my 2 cents as well: 1492 was also the year that Christopher Columbus discovered South America, and the year Martin Behaim constructs the first surviving globe of Earth, the Erdapfel. Columbus didn’t return from his voyage until 1493, so the Erdapfel was missing the New World he dicovered – Just like the map found in the game. Also the notes to Ode to Joy that have been found – Ode To Joy was written to celebrate the brotherhood and unity of all mankind. If we DO take 42 to mean what it does in the HHGTTG, the answer to the life the universe and everything. The question of what is the meaning of life is answered by this timeline given in the game of mankinds achievements – cave paintings, discovering new lands, mathamatics, travelling into space and researching DNA.

    Well that’s what I think anyway.

  • i dont know if this has already been found, but i discovered a golden atomic bomb ontop of an elevator in a medium level

    • Yeah, that is on stock market. There is an achievement for riding the elevator down…

      on that same track is the number 42 clue.. you should try and get that one>

  • just a random thought.

    42 is, as FatShady said, in the HitchHikers Guide To The Galaxy, and is the ‘answer to the ultimate question of life, the universe and everything’.

    in the books, it is the answer to 6×9. It might be coincidence but these numbers keep popping up…

  • It has something to do with the origins of life on this planet and fact we were put here by aliens: The Orion Constellation is aligned with ancient ruins such as the Pyramids of Egypt, Teotihuacan, the Hopi Villages & the Thornborough Henges… Da Vinci was said to have had seen UFO’s. 1300 B.C.E The cave paintings were made before the bibal even says there were people on this planet… The Tunguska Event was NOT a Nutural Explosion sightings of UFO’s seen by locals at time of event also large Metalic Dome shaped objects found at said sight, Explorer got sick by unknown forces when after examination of said objects, said to be Ancient Anti-Aircraft Energy Weapons. And that damn Ancient Map when overlayed on topof a map from today shows that its Identicle meaning that the map would have had to be made from the Air also showing South pole Ice-less at a time historians say it was still covered in ice… Just a guess…

  • I’d say this definately has something to do with the history of man. The cave paintings, the first real recordings of man ever found. Da Vinci’s work, The Flapping Wing, possibly a symbol of man in the air. Fibonacci’s sequence, the process of 1 and 1 making another, The DNA sequence, the true core sequence that makes up man; The Orion Constellation, possibly a reference to space exploration, along with the envelope, as a hope of interacting with the unknown. And the mystery box…Along with JJ Abram’s box, that he’s never opened…he says the mystery is what makes it special, and with the human race already achieving so much, the question is…What will happen next??

    Its a mystery. But judging from the Tunguska clue, it can’t be good…

  • This interview is literally riddled with hints and clues. JJ Abrams, owner of the Mystery Box, was the creator of Lost. The Golden Records were launched by NASA. The Tunguska event was a meteor hitting Earth’s surface. I love Trials. We got so close to hitting the answer, but slowly we started overthinking. Being impulsive was not good either. Now that the answer to the riddle has been released by Redlynx, it seems so obvious. Questions will always create problems and never solve anything, or at least that’s what we thought until we spent 1200 MS Points on the best game ever. Now we are, or at least I am, left wondering, “where did we go wrong?”

  • The secret is only know by one man… Chuck Norris. We humans can sometimes have near death experience, but Death itself had a Near Chuck experience! But one thing I can say about the complex puzzle is… great! Why? Well most easter eggs in video games are just mumbo jumbos, you’ll just find them with no connections at all, in a non-sense way… But this one is different, can’t believe whoever made this easter egg. He bothered himself just to give players some good puzzle-solvin’-creepin-whateverin’ Yeah. All easter eggs in all games should be like this.

Show more comments

Log in to comment on this story!