The Trials HD Riddle: A Look At Gaming's Da Vinci Code

Most of you know Trials HD as the punishingly difficult 2D racer on Xbox LIVE Arcade - but buried deep within the impossible jumps and the incredible physics puzzles is something far more elusive - a riddle. A fiendish riddle that would make Da Vinci dribble. In this one-of-a-kind feature Kotaku reader, and Trials HD obsessive, FatShady breaks down this incredible puzzle and speaks to the creators of the game to try and uncover the intriguing mystery that is... The Trials HD Riddle.

The Beginning

But what is the Trials HD riddle? So far we have very little idea with regards to how the individual pieces hang together - but, for now, it's a series of clues - buried deep within the tracks of Trials HD - clues that work together to create a bizarre mystery that is as yet unsolved, a series of Easter Eggs loosely tied together in a way we can't yet fathom.

Few who play, or even finish the game in its entirety, will be aware of their existence. The clues found so far can be seen in this video.

Surprised? Even aware that these secret areas even existed in a game such as this? We asked FatShady to explain the clues one by one.

The Clues

The Fibonacci Number This secret is a representation of the Fibonacci Sequence or the Golden Ratio. The first two Fibonacci numbers are 0 and 1, and each subsequent number is the sum of the previous two, for example, 0, 1, 1, 2, 3, 5, 8, 13, 21.

Cave Painting This secret is thought to be a cave painting, specifically the 'Lascaux Hunters' from the cave paintings located in France.

Known as "the prehistoric Sistine Chapel," the Lascaux Caves, a cave complex in south-western France, contain some of the most remarkable paleolithic cave paintings in the world, from at least 15,000 years ago. Here is a highlighted image showing the hunter pictured above.

Number 42 The number 42 is thought to be a reference to the movie 'The Hitchhiker's Guide to the Galaxy' and in particular, the 'answer to the ultimate question of life, the universe and everything' (which of course is 42).

Interstellar Envelope The clue here is two circles with a line connecting them.

This symbol has been identified as one part of the Interstellar envelope, a golden record that was placed on the Voyager spacecraft in 1977 and sent into space as a way of humans communicating to other intelligent life. This symbol is located in the bottom right section of the record. While it is not currently known how this image relates to the riddle, it has been suggested that this record has something in common with Leonardo Da Vinci's notebook.

As it relates to the record, this diagram illustrates the two lowest states of the hydrogen atom. The vertical lines with dots indicate the spin moments of the proton and electron. The transition time from one state to the other provides the fundamental clock reference used in all the cover diagrams and decoded pictures.

1452 Given that Leonardo Da Vinci features elsewhere within this riddle, these numbers are thought to represent the year that Da Vinci was born.

Flapping Wing This image shows a hand-like mechanical structure. This is thought to be a representation of a sketch made by Leonardo Da Vinci.

Here is the original sketch made by Leonardo Da Vinci depicting the flapping wing. This image can be found within the book 'Leonardo's Notebooks'.

De Divina Proportione There are two secrets that are provided here. Only when they are combined do they reveal the answer. D__I _IN___OPO__ION_



This translates to "The Divine Proportion", a manuscript by Luca Pacioli which concerns mathematical proportion and the golden ratio.

While the title of the text has been discovered, it seems that the more relevant clue here is the line with dots, along with the number 4 representing a certain part of this image. It is not currently known how this text relates to this image, or more importantly how it relates to the overall riddle.

Fibonacci Pattern with Binary The Fibonacci pattern is again shown here. This secret is special however because in addition to the image, it shows a series of dots below the image. Clues have been provided to suggest that the dots at the bottom of this image are actually binary code (dot = 1, space = 0). It reads 10101001111.

As this is the image of the Fibonacci pattern shown above, has the binary code been reversed? It is not clear exactly what this means. What does this clue signify?

Orion Constellation This secret is located on the level 'Space Station'. Therefore this image is thought to be of a constellation.

These stars represent the Orion Constellation. The three stars in the middle being Orion's belt. The Orion constellation is also known as the hunter. It can also be viewed from within the Great Pyramid in Egypt via a small shaft. This however (considering the responses below), may be a reference to the Orion Spacecraft, which is a current initiative of NASA to explore deeper into space that we have gone before.

Roman Numerals The numbers read: 3-18-15-1-20-15-1-14

If those numbers were deciphered using a simple Alpha-Numeric Substitution Cipher (ie, a=1, b=2,c=3), they spell out the word "Croatoan".

There is a story of a 'lost colony' who carved the word "Croatoan" into a tree in the settlement of Roanoke. This was the only clue given to the group's leader, John White, after he left back to England to get supplies. The English government officially declared the colony of Roanoke “lost” in 1597. It has since, however, been proven by DNA analysis that the missing settlers/colonists were integrated into the Croatoan Tribe living south of Roanoke.

Darwin's Tree of Life Charles Darwin is commonly known for his revolutionary theory of evolution, which would be documented in his work titled 'On the Origin of Species'. During the 20 years he worked on this, he kept a number of notebooks. In one of them, from approximately 1837, he sketched the following to describe the evolutionary process.

On a side note, knowing what we do about the theory of evolution and how revolutionary it is, I like that even Darwin writes 'I think' above this image suggesting this idea was in its infancy.

Cardboard Boxes There are two boxes represented in this image.

The box on the left has been identified. It is a recreation of a 'Tannen's Magic Mystery Box'. What is more interesting about this box however is its owner, JJ Abrams (Lost, Fringe, Mission impossible 3). It turns out that Mr Abrams was the guest editor of the April 2009 edition of Wired magazine. This magazine had a large number of puzzles hidden within its pages. It turned out that the puzzles all linked together to form a larger riddle (sound familiar yet?). As these two boxes are located in very close proximity, it is thought that they are connected.

The box on the right of the image however is a complete mystery. The box is cardboard with packing tape over it. It has the writing SU-122 crossed out and below it is the writing SKA-788. In order to progress this riddle, the game developers sent a package out to a fan of the game that was a recreation of the box. This recreation was said to hold a clue to what the box was. Inside the box was a 6.2m panorama that is made up of a series of street view images taken from Commercial Street in London. This street is famous for the Jack the Ripper murders.

Binary Co-ordinates The binary code reads 1011110100111 N, 10011110101101 E

To decipher this one, first binary was converted to decimal, then the decimal outcome was converted to Longitude and Latitude. The result was 60° 32' 59.9994", 101° 34' 11.9994" which is a location in the middle of Russia.

Further investigation resulted in the discovery of the Tunguska Event. This was the site of a massive natural explosion that occurred in 1908. The explosion is believed to have been caused by the air burst of a large meteoroid or comet fragment at an altitude of 5–10 kilometres (3–6 mi) above the Earth's surface. The explosion is thought to have knocked down an estimated 80 million trees.

DNA Sequence This is thought to represent DNA because of the letters used representing the 4 building blocks of DNA (Adenine, Cytosine, Guanine, Thymine).

The letters are thought to read CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT however the image is difficult to read in parts. There are 40 letters in total.

The Map The clue is a map of the world with a piece missing. This map shows rhumb lines radiating from a circular pattern of wind roses or compass roses which indicate various winds and compass directions. This is common in Portolan charts of the 1500's.

The missing piece of the map is known as the Piri Reis Map. This map was created in 1513 but was only rediscovered in 1929. Like other portolan charts of the time, the Piri Reis Map exhibits a network of rhumb lines and compass roses. This is the only surviving remnant of what was thought to be a much larger map.

Mammoth So far, this is just a Mammoth, an extinct relative of modern day elephants. It is not clear what significance this mammoth has to the overall riddle. Could it relate to the modern discovery of a frozen mammoth, or the work currently underway to map the DNA and potentially clone the mammoth? No-one knows?

Speaking To The Creators

In an attempt to dig deeper into this riddle, FatShady spoke to Redlynx Developer ANBA, who not only was heavily involved in the development of Trials HD, but created this riddle. Here is what he had to say.

For the record, what is your real name and title? I am Antti Ilvessuo, Creative Director and Co-Founder of RedLynx. In the forums my tag is ANBA, and on the office wrestling mat, my nickname is “The Dreadnaught,” because I am like the old naval battleships, large and obsolete.

Where did the inspiration come from to create such a complex Easter egg hunt? Always when watching movies or TV series I’ve been more interested in the backstory and world rather than the current plot itself. In my mind, it creates a deeper feeling and interest toward the "product". And about Easter eggs, they are in my mind more than that, since Easter eggs are usually just fun, goofy stuff. These are secrets that have "meaning."

Something like Lost had a lot of pretty good stuff that really pointed out the way that things have been thought in the background. Of course I was not a big fan of the ending, but the journey of watching Lost was a fun one. Maybe that was the meaning of the series, I don’t know.

Also I think the Lord of the Rings had some influence on this. I’m not a big fan of the book in the way that people usually are, more like I think it’s just awesome that there is a real history behind the books and events there, not just a made up slice of the universe.

It has been 18 months since the game was released and while progress has been made, no one has solved the riddle. Do you consider an unresolved riddle a success or a failure? Success definitely, both personally for myself and for the people that are looking to solve it. If it would have been nailed in first day...what good is that? Many small details would have been lost, some small information or interesting facts. Nobody would have found those. Some missteps could not have been taken, but those always are good. You learn and your imagination and desire to know would have not been tickled. All lost forever. So no, unsolved riddles are not failures, not at all.

Are you concerned that this riddle will never be solved? No. ;)

How hard has it been to keep this secret to yourself for so long? Does anyone else know the answer? Not hard. Most people don’t even know that it’s there. Some know it’s there, but they know I won’t say anything. Our P.R. director knows the answer - I told him because if a meteor hit me, the answer would be lost forever!

That might sound like a strange fear, but meteors come close to Earth all of the time. I have instructed my IT guys to set up a screen in the office that constantly monitors all meteors and near-Earth objects at all time, using the data from this NASA website.

Finland is known as the land of 100,000 lakes, and I fear that another will be created by falling meteor. If it should land on me, they can call it Lake Antti.

The most common question I hear is from people who don't even know what they are looking for. For example, is the riddle a phrase, a movie title, a poem, a person? What clue/s would you say hold the 'key' to linking the clues together and finally solving this riddle? There are two things. What is the question AND what do the things that have been found so far mean? Right now, people stop when something is confirmed maybe just too bit early. And hmm, as to the question. Well maybe there is hint in this answer?

They stop and don’t seem to think about the combination of all things and what they could mean. Like the map, you found part of it but then what? How could we have a map that is not found? What is the map that we have?

Finally, has any clue been missed or 'solved' incorrectly? Would like to correct/point us in the right direction? There was a box that was opened. It said, “Don’t open it!” so that was a turn in the wrong direction. Maybe the box would be more meaningful if it were closed, not opened.

But otherwise it’s all been pretty much good. Hmm, regarding Ode to Joy: the notes are from the song, but they don’t form code. If they would have made been in code, that would have been really awesome. Or maybe there is code in Ode to Joy actually, but that was not the meaning. But if there is a code in there, the composer is freaking genius! Well actually he is anyway, so maybe there is a code in there too.

If there would be ultimate secret code, something like to live, to err, to fall, to triumph, to recreate life out of life… would be cool.

The Solution

We asked FatShady what he thought the solution was - and he had this to say...

This is perhaps the best part, the solution is still unknown. This is the first interview of its kind and there are certainly new clues contained within the above response. While a number of clues have been laid out before you, their meaning and how these all link together has not been solved. This provides a unique opportunity for everyone reading this to get involved and help get to the bottom of it. It only takes one person to recognise a clue and the rest just falls into place.

The secrets do seem to tell a story of sorts, a journey of man through the ages from cave men to the age of discovery and onto space exploration. It also seems to relate to the progress the human race has made though science and mathematics. This is only a loose grouping of what ultimately is a vey specific riddle.

While it may seem overly complicated when you see the variety and complexity of what has already been uncovered, trust me when I say that as we started out on this journey, no-one knew what a Caesar Shift was, or the Tunguska Event, or who Piri Reis was. These have all been made through simple curiosity, research and a bit of hard work.

Everyone can contribute in some way, even if it is spreading the word about this riddle. I encourage all of you to be curious and ask questions. Join in on the conversations on the Redlynx forums and if you have an idea, even if it sounds strange, speak up.

DISCLAIMER: I must point out that I take no credit for discovering these secrets, and have only contributed a relatively small amount to solving these to date. A special thank you must be given to all of the Redynx forum members who have contributed to solving parts of this riddle over the past 18 months.

For further information or to assist in anyway, please see the below links:

Redlynx Forum, Easter Egg thread

Trials HD Secrets wiki

Thanks to FatShady for the incredible amount of work in pulling all these sources together.

WATCH MORE: Gaming News


    Sweet Lord that looks good up there... now PLEASE HELP ME!

      it was me... i admit it. i 'opened' the 'do not open' box... cant undo the past. that has to be the worst part of life... the absolution of past.

        haha... when i got that response back i did cry a little for you..

    Epic work Fatshady, my mind boggles at the work that's gone into investigating these.

    Have any other game creators ever done such a complex series of easter eggs? The amount of time and effort that must have gone into implementing these in the game... craziness.

    Jesus Flipping Christ.
    Just... wow.

    Random thought - what do we know about the rider of the bike? They're always wearing a helmet, so what is behind the visor? And what is their purpose for doing all this crazy riding? Perhaps the clues answer these questions in some way...

    'There was a box that was opened. It said, “Don’t open it!” so that was a turn in the wrong direction. Maybe the box would be more meaningful if it were closed, not opened.'

    Reference to Pandora's Box?

      The box with the question mark is a box that JJ Abrams has.. He game a talk on TED ( and in this he explains that he has a box that he has not opened since childhood. He said that the mystery was more valuable to him than actually opening the box.. The mystery made it special.

      I think what ANBA was referring to was that the box he sent to the fan of the game could have been solved without actually opening it. So in a way, ANBA wanted to create something special for this fan, never really knowing what it was. I dont think we ruined anything, but some of the mystery has gone...

      Dont let me stop you investigating that though?

      no, it was a reference to my box which was a tannens mystery box mock up. i earned it from the devs and it specifically said do not open. of course the axxhole i am, i opened it. inside were 3 magic books. (later we were told that the contents of the box didnt necesarily relate to the overallriddle but served as clues about the boxes. you can watch the video of me opening the box and displaying the contents on youtube
      redlynx secret box prize.
      the books are quite interesting and expensive.

    Holy Fiddlesticks, that was awesome, great work FatShady! As for the puzzle.. er... um... mmm... Quick, look the answer is behind you.
    *jumps out the nearest window*

    And I thought I was just killing time with a cheap fun motorbike game...

    Also, on the cardboard box, 788 - 122 = 666

      I had spotted that I think but while freaky I made nothing of it... Anyone else can elaborate please do.

        Jack the Ripper sent a police officer (?) a cardboard box containing part of a wine-soaked human kidney, along with the 'From Hell' letters...

          Can you find an image of that box.. I couldn't. May be useful?

      Except if he was going to add that it it will have to be the pop culture meaning for 666. because the original 'devil's number' is 616.

    Tunguska was featured in the X-Files.

    I'm helping.... right?

    Also, awesome story Shady! My blind may even be somewhat mown. Good luck solving it!

      Nice.. I had not seen that one... Interesting *ponders*

    Wow. Great read. Wish I had a 360 so I could check this out.

    I had a hard enough time finishing the tracks without noticing the background.

    Well done to anyone who even noticed there was a riddle at all.

      **just one more turn
      **last attempt
      **I'M COMING ... geez
      **GIMME A SEC!!!!
      **Ill be in soon
      **There's no way you'll ge it bro, Ive been trying for hours
      **How'd you do that?
      **I hate you


    I'd love to help, but it took my entire lunch break to read through all of that, and i went cross eyed.

    This is COMPLETELY beyond me.

    Absolutely EXCELLENT work though, mate :)

    lol, and I thought this game was something else entirely.

    Excellent write up and interview FatShady, I am really curious to find out what the answer is after this amazing lead up..

    I've already solved the riddle. The answer may surprise you. The developer gave a big hint when talking about meteors ;)

      As hard as it is to say, I am half expecting this... We have reached the limits of what we know so the purpose of getting this riddle out in the open was to find other people that may have the answers... please do share?

        Your not thinking elenin/niburu stuff are you?

        I'm kidding. I was going to do an incredibly complicated follow the clues type thing that eventually put all the blame on Spiderman.

    That was insane. So much detail. Great work FatShady! Is this only on XBLA? I might have to invest in another 360 to try games like this out.

      XBLA exclusive.. New game also coming out later this year - 'Trials Evolution'

    Any on these in the game?

    Oh well done FatShady! You can tell you've put a lot thought and work into this.
    I wasn't interested beyond mild curiosity before but now you've got me thinking about it.

    Such an awesome read. The Answer? I am going to say ... its a recipe for a delicious sour dough bread with cheese and mammoth juice.

    Awesome awesome job Fats!

    I'm gonna be a bit of a party pooper now though and query - why have a riddle involving these elements in a game about a dude riding a motorbike? I love the idea of it and all but, these things seem totally disconnected from this kind of game. /end negative response

      I'm not having a dig at you at all Fats, I think you've done a seriously amazing job with all this! I'm just wondering how all this will relate to a mtorobike rider... maybe the answer makes that more clear?

        Its all good man.

        I dont think it has anything to do with the bike. I just think that ANBA was having a laugh and thought this would be a cool idea.

    So fantastic to see this article put up here!! Here's hoping someone comes up with some cool ideas and new paths to try!

    I give a massive pat on the back to the god of a man, FatShady. The amount of time he has sweated on this is freaking amazing! Congrats man!

    42 is thought to come from the MOVIE hitchikers guide to the galaxy?

    I'm sorry, movie?

      Radio, book/s, TV... everything BUT a movie.. oops.

        When condensing so much information into written form it's expected that a couple of mistakes would make it into the works ;)

      Why is everyone stopping at a pop culture reference with 42? Not in tone with everything else. Try these maybe?

      * Given 27 same-size cubes whose nominal values progress from 1 to 27, a 3×3×3 magic cube can be constructed such that every row, column, and corridor, and every diagonal passing through the center, comprises 3 cubes whose sum of values is 42.

      * Forty-two is a pronic number and an abundant number; its prime factorization 2 · 3 · 7 makes it the second sphenic number and also the second of the form { 2 · 3 · r }. As with all sphenic numbers of this form, the aliquot sum is abundant by 12. 42 is also the second sphenic number to be bracketed by twin primes; 30 is also a pronic number and also rests between two primes. 42 has a 14 member aliquot sequence 42, 54, 66, 78, 90, 144, 259, 45, 33, 15, 9, 4, 3, 1, 0 and is itself part of the aliquot sequence commencing with the first sphenic number 30. Further, 42 is the 10th member of the 3-aliquot tree.

      * 42 is the product of the first three terms of Sylvester's sequence; like the first five such numbers it is also a primary pseudoperfect number.

      * It is the sum of the totient function for the first eleven integers.

      * It is a Catalan number. Consequently; 42 is the number of noncrossing partitions of a set of five elements, the number of triangulations of a heptagon, the number of rooted ordered binary trees with six leaves, the number of ways in which five pairs of nested parentheses can be arranged, etc.

      * It is the reciprocal of the sixth Bernoulli number.

      * It is conjectured to be the scaling factor in the leading order term of the "sixth moment of the Riemann zeta function". In particular, Conrey & Ghosh have conjectured

      {1 \over T}\int_0^T \left| \zeta\left({1 \over 2} + it\right) \right|^6\,dt \sim {42 \over 9!}\prod_p \left\{1-{1\over p}\right\}^4 \left( 1 + {4 \over p} + {1 \over p^2} \right) \log^9 T,
      where the infinite product is over all prime numbers, p.[1][2]

      * It is the third pentadecagonal number. It is a meandric number and an open meandric number.

      * 42 is a Størmer number.

      * 42 is a perfect score on the USA Math Olympiad (USAMO)[3] and International Mathematical Olympiad (IMO).[4]

      * In base 10, this number is a Harshad number and a self number, while it is a repdigit in base 4 (as 222).

      (thanks wikipedia!)

    I'd just like to point out Annti suggests not all the clues have been found and at least one may have been interretted the wrong way. In the case of the box, I'd suggest working out ewhat the original marking was before it was resealed.

      The way i read it he says all clues have been found. What quote are you referring to?

      The markings were SU-122 crossed out with SKA-788 in its place.

        He was probably referring to this part of his response, I believe: "What is the question AND what do the things that have been found so far mean?".

    This is so effing cool. I had no idea about any of this.

    I think Trials HD is on my DL pile now.

    One other thing, ANBA is known for giving clues in his responses. I found this last week but have not made anything much of it yet...

    He said "to live, to err, to fall, to triumph, to recreate life out of life", which is actually a quote that was hidden in the first ever synthesised DNA sequence.

    This is the presentation that gives detail to the cipher used. What I was thinking was that the DNA above can be cracked using the same cipher that was used to encode the DNA sequence.

      I've done a bit of searching around this, and spent a good deal of time trying to put it together, but I can't see anything useful. Any chance there are other images of that sequence? Some of the letters I'm not too sure about. sir are a freak.
    Riveting stuff mate. Bravo.

      I think the question is...
      What do you do when you fall off the bike?
      And the answer would be...
      Try and try again...

      Explains a few things, darwinian evolution, da vincis attempts at flying, the remapping of the world, the trips to the moon...
      More than likely wrong but cant hurt to have a stab...

Join the discussion!

Trending Stories Right Now